Skip to main content

Table 1 Primer sequences and resulting product size of RT-PCR with genomic DNA and cDNA as template

From: Organelle-specific isoenzymes of plant V-ATPase as revealed by in vivo-FRET analysis

  Primer Sequences genomic DNA [bp] cDNA [bp]
c"1 (At4g32530) F: AGAGAGAGAGAGAGAGAG 1578 561
  R: CTATTTTGTAGGCCATGT   
c"2 (At2g25610) F: TCAAATTCATTCATATCA 943 570
  R: CTATTTTGTAGGCCATGT   
c1 (At4g34720) F: ATTTCAGATTTAAGATCT 979 531
  R: TCATTCGGCTCTGGACTGACC   
c2 (At1g19910) F: GTCTCATTCCCGATCAGA 1039 532
  R: TCATTCGGCTCTGGACTGACC   
c3 (At4g38920) F: AGCACATATTTTAAGATC 1617 528
  R: TCATTCGGCTCTGGACTGACC   
c4 (At1g75630) F: ATCTCATCGGAGCAACAG 1402 532
  R: TCATTCGGCTCTGGACTGACC   
c5 (At2g16510) F: ATCCAAAACTTTGAGATC 829 519
  R: TCATTCGGCTCTGGACTGACC