Skip to main content

Table 1 Oligonucleotide sequences used for cloning of mouse Ndrg2 3’UTR, the predicted miRNA seed sites or their scrambled mutated versions

From: MicroRNA suppression of stress-responsive NDRG2 during dexamethasone treatment in skeletal muscle cells

Oligonucleotide: Sequence 5’-3’:
mNdrg2_3’UTR-F: caccgctagcatgaccctcattgccttggtg
mNdrg2_3’UTR-R: cgatctagaaacaatgctgttcagtttcctcta
miR23seed-F: caccgctagcggtgggtcagtgatccttaatgtgatagaaatatccgcggg
miR23seed-R: cgatctagaggatatttctatcacattaaggatcactgacccaccg
miR23mut-F: caccgctagcggtgggtcagaatgttagtctcatgtagaaatatccgcggg
miR23mut-R: cgatctagaggatatttctacatgagactaacattctgacccaccgagct
miR28seed-F: caccgctagcttaacctgtgatatcctctagctcctaggtgaggccgcggg
miR28seed-R: cgatctagaggcctcacctaggagctagaggatatcacaggttaagagct
miR28mut-F: caccgctagcttaacctgttcatcgttactcactgcaggtgaggccgcggg
miR28mut-R: cgatctagaggcctcacctgcagtgagtaacgatgaacaggttaagagct